Top Posts Tagged with #faq | Tumlook (2024)

WOO, finally got this ref chart together! the art's actually kinda old by now (I started this back in february) but I didn't feel like redrawing everything outside outfit changes sooooo,,,,,my apologies 😅 here's the main cast! you can find individual refs in this masterpost

MCYT SEXYMAN WINNER JOE HILLS

[ID: the sexyman bracket, showing that the final winner is Joe Hills]

my storybook is now live! link to PO on my profile!!! (rbs are appreciated!)

happy 3rd life anniversary! 💚💛❤️

TWIN RUNES MASTERPOST

1 - 2 - 3 - 4 - 5 - 6 - 7 - 8 - 9 - 10 - 11 - 12 - 13 - 14 -15 - 16 - 17 - 18 - 19 - 20 - 21 - 21-1 - 21-2 - 21-3 - 22 - 23 -24 - 25 - 26 - 27 - 28 - 29 - 30 - 31 - 32 - 33 - 34 - 35 - 36 - 36-1 - 37 - 38 - 39 - 40 - 41 - 42 - 43 - 44 - 45 - 46 - 47 - 48 - 49 - 50 - 51 - 52 - 53 - 54 - 55 - 56 - 57 - 58 -

59 - 60 - 61 - 62

To be continued...

TWIN RUNES MINI COMICS

Glasses - Fallen down - First steps - Press [C] - Frisk Dance - But nobody came - Whatstheirface - An acquired taste - Eye opening - Smalltalk - Connection issues

______________________________________________________________

TWIN RUNES - FAQ

What exactly is this AU about? Twin Runes is essentially a comedic crossover AU between the universes of Deltarune and Undertale. No fancy nicnacs. Just the characters being their chaotic selves. But there might be some darkness lurking up ahead...

When is the next comic?The comic updates most Sundays at 6:30 PM Central European Time.

Why is this AU called Twin Runes? The name is more or less a play on the typical naming format of most AU's by featuring the "Runes" part. There are no literal Twin Runes. The whole name is more of a stand in for Undertale and Deltarune as parallel worlds. Hence the "Twin" part.

When does Twin Runes take place? This AU takes place between a hypothetical Chapter 3 and Chapter 4 of Deltarune. On the Undertale side of things, it takes place post neutral route just as Frisk was about to deliver Undyne's letter to Alphys.

how many pages are there going to be?The script for this comic estimates that the comic is going to be 137 pages long (if I don't make any major changes).

Is the player a thing in this AU? The player lost control over both human children as soon as Frisk entered the world of Deltarune.

When Chapter 3 and 4 are released, will it affect the story?Any chapters after Chapter 3 won't affect the story in the grand scheme of things. If possible, I might make a reference to Chapter 3, but all in all Twin Runes created a new timeline so to speak.

What's up with Kris' and Frisk's hair? The red bits of their hair is more or less a representation of their souls. That in turn is also why Chara doesn't have that feature. They are soulless. It's a stylistic choice.

What's that thing on Kris' chest? It's a scar they got from tearing out their soul.

And why do they have weird lines all over their body? Both Kris and Frisk's anatomy resemble that of ball-jointed dolls. They appear just as markings across their bodies. Think of them as elaborate birthmarks. Kris and Frisk are still made of flesh and blood, but are in fact hypermobile. The reason as to why they do is still a little secret :) People here like to refer to these markings as "puppet limbs". You can get a better look at them and the scar in this artwork

Why does Kris have braces?This is why:

Why is Dark World Frisk green? Frisk changes their main sweater colors with Kris when they enter the Dark World.

Can other ghosts see Chara? (pre Darkner transformation)No, only Frisk and Kris are able to see Chara.

IS KRIS NOW FRISK'S COUNTERPART OR CHARA'S????:)

So, was Chara in the locket all along? No, Chara possessed the locket to become a Darkner.

Where are Jevil and Spamton? Are they in Castle Town?The Fun Gang have already fought these two in the previous chapters and added them into their inventory. Outside of that little dream sequence, neither will be making an appearance.

Is anyone from Undertale Yellow gonna make an apperance?Outside of a tiny cameo from Clover (that has no greater bearing on the story) no one from Undertale Yellow is going to make an appearance.

Is (insert character here) gonna go to the Dark World/underground?With the way the story is going to play out, only the main group will be heading to this new Dark World. The rest of the story will be taking place there.

Is the Group Project miniseries canon to Twin Runes?It was made before Twin Runes was conceived and before I had any idea I would make a series. It is it's own self-contained story. So it is NOT canon to Twin Runes, but You can read it here:1 - 2 - 3 - 4 - 5 - 6

How did you come up with the idea of Twin Runes? Twin Runes is an offshoot of a separate script I wrote. It's a similar concept but turned on its head. The funny moments in that script made me just continue what now is the start of Twin Runes. I pretty much just wanted to see if I am actually capable of drawing a comic to begin with. So... in a way Twin Runes is my first attempt at a comic ever. If I ever finish Twin Runes, then I know I can tackle turning that mammoth project of a script into a comic too.In the grand scheme of things these two projects are sister series. They have A LOT in common and even share similar plot elements. When Twin Runes is over you will automatically also know certain mysteries of The Other Script.

What is The Other Script? As of this moment I call The Other Script: "Lost in the In-Between". At its core it's an inverse of Twin Runes. I.e. Kris falling into the underground and being aided by Frisk on their quest to return home. The story and jokes are a considerably more grounded than in Twin Runes and so are the characters. Though they do have their moments from time to time. The overall mood of that script is a lot darker in nature and it's a 200+ page passion project of mine.

Am I allowed to make fanart? ABSOLUTELY! You are very welcome to make fanart if you feel like it. Please let me know if you do by tagging me, so I can share it with everyone to see so that you get the appreciation you deserve :)

Can I use the funny faces you draw for memes or for private stuff with friends? That's what they're here for :)

Is there x ship in this comic? The focus of the story is not on shipping. If it's in the game it will very likely be mentioned or brought up, but that's about it.

What pronouns do you go with for the human children? I try to stick as close as possible to the games so I use THEY/THEM FOR ALL OF THEM WITHOUT ANY EXCEPTIONS.

______________________________________________________________

ABOUT ASKS

Asks will open for 24 hours after a new comic has been released. Your questions will then be answered over the course of the week.

Try not to submit multiple asks. If necessary, just keep everything in one post.

Keep in mind that I receive AL LOT of asks, so not every question can be answered...

Questions containing spoilers will not be answered on principle. Wouldn't be as fun if the surprise was ruined, right?

Before leaving an ask (mostly for everyone who's new), please make sure to read the FAQ section above. A lot of times your question might have been answered already :>

I love memes and dumb jokes as much as the next guy, but try not to spam

It probably goes without saying, but please stay civil. I want to give everyone the respect they deserve, and naturally like to be treated the same way.

Please be mindful about drawing requests. It is understandable if you're eager to see a certain character drawn in my style, but I do not like to be bombarded by requests. The more it happens, the less likely I am to do it. Be kind and ask nicely.

Don't use other people's posts that I reblogged to ask me questions! It has happened before and I do not wish to see this!

______________________________________________________________

REFERENCE SHEETS

The following are ref sheets of characters that don't have established Dark World forms yet (as of writing this comic). The list will be updated as soon as a new character enters the Dark World. Here you will also find references of characters that might appear as surprise cameos, or maybe even completely new faces...

______________________________________________________________

FULL ART

WARNINGS / FAQ / REQUESTS

asks are open! check here before sending :) (updated 3/10/24)

banned from BLAST for being too sexy

CREATURE WARNING:

this blog posts BEASTIES and ORGANISMS. if you are uncomfortable with seeing any manner of organism (spiders, rodents, fish, etc) please block the tags for that organism before following/browsing.for broad categories: i tag in plurals (insects, bugs, fish, rodents, parasites, pathogens, plants, trees, etc.)for specific organisms: i tag in singulars (dobsonfly, eurasian harvest mouse, etc.)for disease causing bacteria: i tag the illness it causes (malaria, botulism, etc.)ADDITIONAL BUG WARNING: this blog posts a LOT of insects, especially moths. FOR SCREENREADER USERS: by the nature of this blog, 99% of my posts will have large sections of unformatted letters, and therefore aren't very screenreader friendly. If I ever miss a tag or you'd like to request that I tag something, please send me a message.

FREQUENTLY ASKED QUESTIONS:

Are you a bot?:no, just neurodivergent

How do you do this?:i delete everything in a message except for the letters A, T, C, and G. then, i BLAST it with my wizard beams.

Are you Italian?:my lawyer has advised me not to answer this question

How do I request things?:read the REQUESTS section of this post :)

Why are there so many bugs???:1. insects make up almost 80% of all animal life on earth2. they are relatively easy to study, so there's more bug DNA in the BLAST database.

Okay but why so many MOTHS???:because scientists are not immune to bias. moths are pretty looking and easy to study, so there is more moth DNA in the BLAST database.

Do the punctuation marks/emojis mean anything to BLAST?:no, i just keep them there after my first pass of a text so you can easily recognize i'm using that same text to find an organism.

Can I send in general questions?:yes! but they may get BLASTed.

REQUESTS:

to request something, please read this section and then send an ask.asks that don't follow these guidelines will be deleted, and may get you blocked.

For questions: make sure it hasn't been already answered in the FAQ, then send.

For songs, poetry, bible verses, or otherwise long text (over 1500 characters, or text with a lot of spacing): send a link to the text or a pastebin with the text in it.

For Tumblr posts: send a link.

For other languages: make sure it's romanized (in latin script), then send.

REQUESTS I WILL NOT ANSWER:

things i have already answered. search the blog for whatever you're about to submit, and check the Frequently Requested section before sending.

private information (name, address, etc. YES people have tried this.)

images (including images in your text is fine, as long as there's enough text that i can search with it)

AAAAAAAAAAA, GATCAGTCAGATTCCGACGGT, CATCATCATCAT, etc. get creative with it.

spam. you only have to send a request once.

homestuck

FREQUENTLY REQUESTED:

The Bee Movie Script, navy seals copypasta, AM hate monologue, All Star, Yoshikage Kira, Never Gonna Give You Up, man door hand hook car door, Big Bill Hells, FNAF Connection Terminated, JURGEN LEITNER, Eggman's Announcement, Free Bird, Spiders Georg, Weed Smoking Girlfriends, Ebony Dark'ness Dementia Raven Way, Minos Prime, Steamed Hams, (this list will be updated as we go!)

thank you for reading! as a treat, enjoy this Strelitzia reginae, or Birds of Paradise flower. :)

WritingWithColor FAQ: How do I start writing a character of color?

First, be mindful that no race, culture, or ethnicity makes one inherently predisposed to certain emotions or personalities, despite what stereotypes or TTRPGs may suggest. We are all humans who share the same range of emotions and ways of thinking, even if we have different values.

Understand that there is no single template for a good [race, ethnicity] character. A person’s social, economic, and geographical background influences their life and values just as much as their race, culture, or religion. Consider: a Black American boy who grew up in a California mansion versus a Black American boy who grew up on an Illinois cornfield versus a Black boy who grew up in an apartment one city over. All three will have very different privileges, disadvantages, and outlooks on life.

Further reading (WWC x NaNoWriMo):

The Do’s of Writing PoC

Properly Coded: Creating Characters of Color

3 Ways to Show a Character's Culture

---

This Q&A is an excerpt from our General FAQ for Newcomers, which can be found in our new Masterpost of rules and FAQs. For more general resources on POC representation, check it out!

-Writing With Color

head up if you don’t want tumblrs partnered ai companies automatically scraping your blog for image datasets, you need to manually opt out.

You can’t do this in the app rn (apparently you can but I couldn’t find it so you might have to update), only the desktop version or web browser on your phone. It will also need to be done for every sideblog you have.

You find it by opening up your blog settings > scroll down to visibility > prevent third party sharing

As an aside, I’d thoroughly recommend opting out of having your blog scraped, even if you’re not an artist. Afaik Tumblr hasn’t explicitly stated which companies they’ll be partnering with, but the vagueness of that wording is really alarming.

These datasets use a lot of selfies for photorealistic results, moderation of who has access to these datasets is notoriously ass, and a lot of AI engines are being used to generate p*rnography and racist imagery (you can see this rn with the rise of ai generated propaganda). While ‘your likeness is used in an awful generated image without your consent’ IS a worst case scenario, it’s a really upsetting one. Protect yourselves.